I'm looking for a new small, efficient media player.

dav7 · 2008-09-09 12:23:36

Hi there.

The background that will give you insight into my situation but doesn't need to be read

I come from a very cushioned past media-wise. When I really started to get into listening to music I was still using Windows. It was Winamp first, which I liked but found a little much, but a few coincidences later found XMPlay, a free but closed-source media player capable of playing not only some weird file formats such as MO3, MOD, IT, XM, S3M etc, of which I have a few files in this format, but also MP3, OGG, WAV, and all the other general stuff out there. The timing was just perfect and I "grew" into my "media years" with this player. I used it across my transition from Win98 to XP, and also used it on a Win95 laptop - and I don't even think I had to "help" the system "like" the player to make it work, although I could be wrong.

However, XMPlay has no Linux version, and as far as I can see, no porting is planned. And as I said before, it's closed source, so not much can be done there.

In my setup I had a machine set aside for media playback because it had a SB16 in it, and I'd run it with the bass set to 100% and treble set to 0%. Despite what you might think, the output was awesome with headphones - it could give me a good headache or two without distorting at all.

So, when I first switched to Linux, I didn't initially switch this machine over, but left it running Win98. This got to me in the end so I switched it over... and immediately faced issues. Since there was no port of XMPlay, I needed to find a new player, and fast. XMPlay has a bunch of audio postprocessing features I had enabled, none of which I found support or equivalents for in Linux (for example, an EQ setting promoting bassboost, in addition to that provided by the card - you can understand the headaches). I eventually gave up and ran XMPlay using WINE... and left it that way, for several months. I mean, it worked, didn't it? Then the fact that XMPlay over WINE on a 450MHz processor (it's a P3, haha) used 50%+ CPU -minimum- for the player to even be running (IIRC) got to me, so I decided once again that a new player had to be found. After some digging, I found XMMS to be the most likely candidate (it supports LADSPA and I could configure a bass-boost filter), and for the most part, it worked well. Quite well.

Then... after I recently found myself recording some audio from the SB16's output to my main machine's input (the simplest way to get around the issue that the bass boost isn't very easy to feed back into the card - or impossible, I haven't tried it for so long), and had my headphones connected to my desktop to monitor the recording. Then, after that was done, I somehow started listening to some other piece of music (through my main box), for whatever reason. I immediately noticed a rather stark contrast in quality to what I'd recorded from the SB16 and what I was listening to. A doublecheck later confirmed that yes, my SB16 was of terrible quality, and yes, I needed a solution, since I wasn't gonna listen to that kinda sound quality anymore now that I knew.

Over the past few weeks (months?) up until this point I've slowly been weaning myself off the music I liked so much (XMs and MODs, and maybe the occasional S3M), and the postprocessing features I thought had glued themselves into my ears....

The, uh, like, point.

....so I need a media player that doesn't have much in terms of sound processing, but meets all the following requirements, either built in or as a plugin (as logically applicable):

* Can hide completely, leaving only a hotkey to bring it back. I don't use a system tray and don't want to, for any purpose.
* Is written in a compiled language.
* Has configurable global hotkey support
* Isn't bloated, dependancy-wise, filesize or memory-wise, or desktop-real-estate-wise - something that uses basic C and has a basic GUI preferred
* Controls the hardware volume so that volume changes are instant
* Supports tracks longer than 60 minutes / 1 hour
* Has good file management / playlist support
* Is something I can throw a gigantic directory tree at and expect to load all the music in it, FAST. I could throw my entire 32GB HDD at XMPlay when I wanted to see/remember what new music was on it and I'd just leave it alone for slightly under 5 minutes. When I returned to it, bam, playlist. That was on the 450MHz P3, running Win98. XMPlay also gave me feedback - if you can recommend something that shows me where it is on the filesystem, that'd be great.

Up until now, Audacious has met those requirements. But it's had the following issues:

* The track details window won't open for random tracks
* The time display stuffs up for tracks longer than >60m, showing the position at 0:59, then, 1:40, then after 10 minutes have passed 1:41, etc
* The volume control randomly forgets how to change the volume, and I refuse to change the controller to use a software volume since it'll induce delays
* The system has no ability to add directories recursively - this was present in XMMS, but the BMP guys removed it (?!?!?!) and since Audacious is a fork of BMP, ...
* The latest version's global hotkeys plugin restores the window to a non-changeable location when I use the "toggle player windows" function. As a visual person I find this a huge blocker.

Now for the list of players that don't do what I want. XD

* mpd - expects all your files to be in one folder; mine are everywhere, even thrown across sshfs mounts to other systems.
* audacious - ...
* xmms - too boring. GTK1. old stuff. unsupported.
* xmms2 - seems too "unreachable". I haven't tried this player yet, mostly because Arch has no clients in the repos. *stab*
* banshee - 200TB of dependencies, and it needs 400TB of RAM to run. Read: I dislike Mono.
* rhythmbox, banshee, amarok, exaile, quod libet - iTunes-ey UI. I hate iTunes-ey UIs.
* songbird - depends on the Gecko rendering engine. I have 512MB RAM, and I already run Firefox, thanks.
* bmp, xmms, audacious - winamp-ey UI. I want to move away from winamp-ey UIs.

If you have any suggestions... I'll be amazed.

-dav7

Last edited by dav7 (2008-09-09 12:55:22)

IncredibleLaser · 2008-09-09 12:43:08

Can't really help you as I use MPD, but the AUR has clients for XMMS2. Perhaps Abraca is for you? I haven't tested it intensively though. Tip: When trying out XMMS2, take xmms2-git from aur and update it (last change is only one week old or so).

Xyne · 2008-09-09 12:45:40

pacman -S vlc

I only skimmed what you wrote so don't stab me if vlc doesn't meet all of the requirements in your post. Here's the web page: http://www.videolan.org/vlc/

It's in "extra", so it's easy enough to try out.

Last edited by Xyne (2008-09-09 12:47:20)

fflarex · 2008-09-09 12:46:08

You've basically eliminated every good player on linux... I think you are looking for something way too specific. There are plenty of linux iTunes clones and Winamp clones, but you're not likely to find a single XMPlay clone. And how is quod libet "iTunes-ey"?

My advice to you is to simplify your media collection and give some of these players another chance. If you *really* don't want to move everything into a single folder, try quodlibet. You may have dismissed that one a little too early.

Personally, I use MPD with Sonata and ncmpc.

dav7 · 2008-09-09 12:54:56

Xyne: VLC doesn't have playlist support, but thanks anyway.

fflarex: Sorry... I forgot to add quod libet to the "uses python" list. This is a fairly old computer. It works (it has a 2.66GHz processor), but it's slow because it's old (the FSB and RAM are ~100MHz, to be exact). So I don't want to use "slow" stuff, and something tells me Python is just gonna be majorly slow on here, and slow half of everything else down.

I've added the following to my original post:
* Can hide completely, leaving only a hotkey to bring it back. I don't use a system tray and don't want to, for any purpose.
* Is written in a compiled language.

I can't simplify my media library because I need new HDDs, and HDDs in the size I need (1TB) only come in SATA. "Half height" SATA cards don't exist, and my server, which has a full-height case, is 500MHz so adding SATA to it would be a joke. Once I get a nice new desktop and server, however, I'll get the chance to sort all my stuff out. Think - I've been living in a pile of wardrobes for 8 years, and I'll finally be able to move into a decently sized room.

Also, I mean that quod libet is "itunes-ey" because it uses the various-stuff-on-the-left-music-files-in-the-top-pane-of-a-vertically-splitter UI style, which just feels "bloated" to me.

-dav7

Last edited by dav7 (2008-09-09 12:58:19)

Xyne · 2008-09-09 12:58:17

dav7 wrote:

Xyne: VLC doesn't have playlist support, but thanks anyway.
-dav7

You can save and load playlists. What other playlist support are you looking for?

dav7 · 2008-09-09 12:59:24

Oh... wow, you're fast

Right, it can load playlists, but it has a "weird" UI to me. Like vim's ex/vi mode is weird to me, and GIMP's UI is (MAJORLY) weird to me. So I'd prefer not to use that. :S

-dav7

Last edited by dav7 (2008-09-09 12:59:57)

GogglesGuy · 2008-09-09 13:08:47

It's 2008 and you finally found out the SB16 is not that good anymore. Welcome to the 21st century...
I think it's time you wrote your own musicplayer. That's what I did...

madhatter · 2008-09-09 13:09:18

dav7 wrote:

* Can hide completely, leaving only a hotkey to bring it back. I don't use a system tray and don't want to, for any purpose.
* Has configurable global hotkey support

Is the hotkey support really necessary? Most Linux player are easy to use remotely, and you can use xbindkey or the hotkey support of your WM/Desktop to control it.
The hiding could be realized for example with wmctrl - It wouldn't be completely hidden but you could minimize it, or move it to an unused desktop

If you're not thrown off by a curses-interface, you could try cmus

wuischke · 2008-09-09 13:13:28

I use xmms2 and control it with hotkeys and using the command line client. I don't use any GUIs, but there are plenty of them, maybe you should test some of them - I can only recommend the player itself.

Xyne · 2008-09-09 13:14:56

I'd love to see a personal ad from you in the paper...

Looking for a girl born within a 3 mile radius of her capital city, with eyes that reflect light that is composed of photons of frequencies that are integer multiples of 3 within the visible spectrum, whose first name begins with M and ends with A but contains no liquids or plosives inbetween. She should enjoy reading books that contain exactly 231 pages printed on paper that is made by hand by people who live in villages that are equal multiples of their distance from the equator away from each other. Ideally, she should have 6,345,215 hairs on her body, with the percentage of vellus hairs equal to the percentage of her pinky over the combined length of her toes, measured by X-ray of her carpal and tarsal bones. Her genetic code should contain 6 unique instances of the sequence ACTACTACTTTAGCATACACCCGCGCGCGCGCTATCGAATATATAATATCGTACCATATCGACGATCGATCGATCGATTATATAT in a non-coding region...

Seriously though, I agree with fflarex... you've overspecified this to death. Perhaps it's time to nag the people at XMPlay to release the source or at least port it to Linux... or code your own.

Last edited by Xyne (2008-09-09 13:36:16)

Roberth · 2008-09-09 13:28:17

This is without any doubt the right moment to develope your own music player.

moljac024 · 2008-09-09 13:32:47

As others have suggested, time to write your own music player!
Or just continue using XMPlay through wine...

Last edited by moljac024 (2008-09-09 13:33:29)

dav7 · 2008-09-09 14:05:23

GogglesGuy: Apparently, my ears only recently discovered this difference. I'm sure there have been times I've tried my desktop's integrated sound before now. Also, I'd want to write my own player in C, or C++, but I'm not up to writing stuff in those sorts of languages yet - I'm still loving PHP. And I'd want to add 92346958793853 features to version 0.1.

madhatter: Well, that would work, but it's a hassle to set up. I guess I could do that if I had to. And cmus looks interesting...

wuischke: Hmm. I don't know... I guess I'll have to give it a go.

Xyne: AHAHA HAHHAAH HAHAHAH HAHAHahaha hahaha...hahahaha ahahaha ahahah...a..... LOL

Roberth: See part B of my response to GogglesGuy.

moljac024: See part B of my response to GogglesGuy. And... well... I don't really want to continue using XMPlay. I did that for long enough. :S

-dav7

Last edited by dav7 (2008-09-09 14:06:25)

arch0r · 2008-09-09 15:22:15

music: consonance (AUR), goggles
multimedia: mplayer, xfmedia, vlc

rsambuca · 2008-09-09 15:31:48

How about mpg123?

mrcold · 2008-09-09 16:42:52

terminal music apps are usually fast and there might be one that meets your requirements. You can use 'yeahconsol' 'tilda' or 'yakuake' or something similar to give it the hotkey support.

I have this setup with MOC and i love it.

btw.. can't you link stuff to MPD's music folder so it doesn't all have to be in the same place??

dav7 · 2008-09-10 00:03:55

Hm. I don't really know anymore... I've stuck with audacious for now, despite all its issues, which I guess will get worked out over time. I may find interest in finding an alternate player in the future, and I'll probably start with all your suggestions. Thanks for your help.

-dav7

NoOneImportant · 2008-09-10 01:49:38

if you use alsa, you can pass you can pass the audio through ladspa dsp's with a little tweaking of the ~/.asoundrc

Berseker · 2008-09-10 16:03:37

well.. if you think amarok has the same ui as itunes..!!

btw, maybe mplayer?

xd-0 · 2008-09-10 16:18:52

Take a look at http://linux.softpedia.com/get/Multimedia/Audio/ maybe you find a musicplayer there that fits your needs.
But if you are not to bothersome with the graphical then moc will be perfect for you.

Shaika-Dzari · 2008-09-10 23:57:01

+1 for moc
No gui, fast, playlist, hotkeys...

Try it.

dav7 · 2008-09-11 05:54:54

I did.

Every time I wanted to change the track, track position, or anything, I had to restore the terminal, make my changes, then minimize it again, And since u, d, <up>, <down>, n, p, a, z, / or * didn't change the volume (all random guesses), I additionally had to open alsamixer in ANOTHER terminal in order to control the volume. Which I oddly found I needed to change a little often, as if at some points the sound was too loud and at other times it was too soft - something I don't have to do with audacious all that often (but do still need to do).

-dav7

xd-0 · 2008-09-11 06:48:32

Im using mpd and have mapped my mediakeys on the keyboard to mpc and alsamixer using xbindkeys.
I fix my playlist and then I can controll it from the keyboard (it cost around 10euro).

You can with no problem do the same with mocp. http://wiki.archlinux.org/index.php/Hot … tions_in_X

coarseSand · 2008-09-11 16:00:25

* Can hide completely, leaving only a hotkey to bring it back. I don't use a system tray and don't want to, for any purpose.

Sonata, disable system tray icon, modify any panel settings to ignore it

* Is written in a compiled language.

mpd is written in C

* Has configurable global hotkey support

Set up keybindings for mpc commands

* Isn't bloated, dependancy-wise, filesize or memory-wise, or desktop-real-estate-wise - something that uses basic C and has a basic GUI preferred

mpd uses basic C, many, many GUIs for it around, extremely small memory footprint

* Controls the hardware volume so that volume changes are instant

Keybind alsamixer commands

* Supports tracks longer than 60 minutes / 1 hour

Is there a modern media player that doesn't do this?

* Has good file management / playlist support

I never use mpd's playlist capabilities, but they do seem fairly extensive.

* mpd - expects all your files to be in one folder; mine are everywhere, evn thrown across sshfs mounts to other systems.

Apparently you have never heard of symbolic links. OH SNAP! Just create a single directory to collect all the links in. Also, mpd does not expect everything to be in one folder; it expects everything to be available from one parent folder, allowing you to organize beneath that parent.

The problem you're having isn't that you're looking for a music player, you're looking for a wm/media player/file manager, and that just doesn't exist on Linux, largely because we are sane (for the sake of argument, ignore Songbird right now, I don't think any of us are crazy enough to use it anyways). Like looking for a zebroctonoceros, even though a zebra exists, an octopus exists, and a rhinoceros exists, they do not exist in the same creature. For interfacing with X (keybindings and the disappearing music player), you're better off going through a configurable wm like Openbox. For the actual music playing, well, I don't see any problems with mpd besides your music files being messy, and you can't expect music playing software to solve a personal organization problem. If your file system is messy, then use a file manager to fix it, not your mp3 player. I put a lot of effort into keeping my music files properly tagged and accessible from a single top level directory called music, which then splits off into mp3/ogg files, flac files, podcasts, etc, and that largely solves the problem of wondering where s--t is.

Another idea for you, if you have multiple machines. Collect all your music onto a single machine, and then set up that system to serve exclusively as an mpd jukebox you can listen to from your other computers over the network. Give it a try.

Last edited by coarseSand (2008-09-11 16:03:31)

Arch Linux

#1 2008-09-09 12:23:36

I'm looking for a new small, efficient media player.

#2 2008-09-09 12:43:08

Re: I'm looking for a new small, efficient media player.

#3 2008-09-09 12:45:40

Re: I'm looking for a new small, efficient media player.

#4 2008-09-09 12:46:08

Re: I'm looking for a new small, efficient media player.

#5 2008-09-09 12:54:56

Re: I'm looking for a new small, efficient media player.

#6 2008-09-09 12:58:17

Re: I'm looking for a new small, efficient media player.

#7 2008-09-09 12:59:24

Re: I'm looking for a new small, efficient media player.

#8 2008-09-09 13:08:47

Re: I'm looking for a new small, efficient media player.

#9 2008-09-09 13:09:18

Re: I'm looking for a new small, efficient media player.

#10 2008-09-09 13:13:28

Re: I'm looking for a new small, efficient media player.

#11 2008-09-09 13:14:56

Re: I'm looking for a new small, efficient media player.

#12 2008-09-09 13:28:17

Re: I'm looking for a new small, efficient media player.

#13 2008-09-09 13:32:47

Re: I'm looking for a new small, efficient media player.

#14 2008-09-09 14:05:23

Re: I'm looking for a new small, efficient media player.

#15 2008-09-09 15:22:15

Re: I'm looking for a new small, efficient media player.

#16 2008-09-09 15:31:48

Re: I'm looking for a new small, efficient media player.

#17 2008-09-09 16:42:52

Re: I'm looking for a new small, efficient media player.

#18 2008-09-10 00:03:55

Re: I'm looking for a new small, efficient media player.

#19 2008-09-10 01:49:38

Re: I'm looking for a new small, efficient media player.

#20 2008-09-10 16:03:37

Re: I'm looking for a new small, efficient media player.

#21 2008-09-10 16:18:52

Re: I'm looking for a new small, efficient media player.

#22 2008-09-10 23:57:01

Re: I'm looking for a new small, efficient media player.

#23 2008-09-11 05:54:54

Re: I'm looking for a new small, efficient media player.

#24 2008-09-11 06:48:32

Re: I'm looking for a new small, efficient media player.

#25 2008-09-11 16:00:25

Re: I'm looking for a new small, efficient media player.

Board footer